Skip to main content
Download PDF

Leu72Met polymorphism of GHRL gene decreases susceptibility to type 2 diabetes mellitus in a Mexican population

BMC Endocrine Disorders volume 20, Article number: 109 (2020) Cite this article

Abstract

Background

Type 2 diabetes mellitus (T2D) is the most frequent type of diabetes. It has a multifactorial etiology, affecting millions of people worldwide. Ghrelin gene (GHRL) encodes the ghrelin peptide, which promotes food intake, induces body weight and adipogenesis. Several single nucleotide polymorphisms (SNPs) in GHRL gene have been associated with metabolic diseases. A protective effect of the Leu72Met (rs696217) polymorphism has been described for T2D in some populations, but this effect seems to depend on the ethnicity of the patients studied.

Methods

The aim of this study was to investigate the association between the GHRL Leu72Met (rs696217) SNP with the development of T2D and serum ghrelin levels in a Western Mexican population. We performed a case-control study in which we included 284 subjects (159 with previous T2D diagnosis and 125 control subjects (CS)). Leu72Met SNP was genotyped by using PCR-RFLPs technique. Serum ghrelin levels were measured using a commercial enzyme immunoassay. Genotypic and allelic distributions were compared using Chi square test. Student T-test and Mann-Whitney U test were used to compare quantitative variables. Odds ratio (OR) was used to evaluate the association between alleles or genotypes and T2D. Multiple and logistic regression models were performed for adjustment. A two-tailed p-value ≤0.05 was considered statistically significant.

Results

Leu72Leu genotype was more frequent among T2D compared to CS (p < 0.05). After adjusting for age and body composition, there was a significant protective effect of the 72Met allele for T2D development (OR 0.40 IC 95% 0.23–0.70; p ≤ 0.001). Fasting serum ghrelin levels were lower in T2D than CS (p ≤ 0.0001) irrespective of age, body weight and BMI. No associations were found between genotypes and ghrelin serum levels in our population.

Conclusions

The GHRL 72Met allele decreases susceptibility for T2D development in a Western Mexican population. Serum ghrelin levels are lower in T2D independently of Leu72Met polymorphism genotype.

Peer Review reports

Background

Diabetes mellitus is an heterogeneous group of disorders characterized by hyperglycemia due to an absolute or relative deficit in insulin production or action [1]. Type 2 diabetes mellitus (T2D) is the most frequent metabolic alteration accounting for around 90% of all diabetes cases [2]. Worldwide, the International Diabetes Federation (IDF) estimated that there were 415 million adults had diabetes mellitus patients in 2015, and predicted a rise to 552 million by 2030 [3, 4]. In Mexico, the prevalence of T2D is 13.9% in adult population [5] and also it is also predicted to increase [6], given the lifestyle risk factors of Mexican population [7,8,9]. Its etiology is multifactorial involving a sedentary lifestyle, obesity, poor quality of diet and genetic factors [3]. T2D courses with a progressive deterioration of pancreatic beta cells, leading to chronic hyperglycemia that conducts in most cases to organ failure such as kidney, liver, retina, nervous and cardiovascular system [10]. Ghrelin gene (GHRL) encodes ghrelin peptide, a 28 amino acids hormone produced mainly in the stomach that is involved in food intake regulation. Ghrelin is an orexigenic hormone that promotes food intake, induces body weight gain and adipogenesis. This hormone is recognized by the growth hormone secretagogue receptor 1a (GHSR1a) which is present in various tissues such as pituitary, myocardium, pancreatic islets and in the hypothalamus. Once the interaction with its receptor is stablished, ghrelin mainly induces the expression of food intake stimulating the neuropeptides: neuropeptide Y and Agouti related peptide and inhibits the expression of proopiomelanocortin, an anorexigenic neuropeptide. Additional functions have also been reported for ghrelin such as: modulation of food reward, olfactory sensitivity, myocardial contraction, sleep, stress and depression regulation [11, 12]. Several polymorphisms exist in the ghrelin gene and some of them seem to be associated with metabolic diseases [12]. In particular, the Leu72Met (rs696217) polymorphism shows a protective effect to T2D in some populations [13, 14]. The Leu72Met polymorphism consists of a transversion of an Cytosine for an Adenine in the position 247 of the GHRL gene, consequently leading to an amino acid change (missense) from Leucine to Methionine in codon 72 [15]. It is known that there is a differential effect of this polymorphism in terms of T2D susceptibility among different ethnic groups [16], so far, there is no evidence about genotypic and allelic frequencies and their association with T2D and in serum ghrelin levels in Mexican population.

Methods

Subjects

A case-control study in which were included one hundred and fifty-nine adult subjects with previous diagnosis of T2D and one hundred and twenty-five adult normal weight control subjects (CS) that did not present T2D was conducted. We included male and female participants of age ≥ 30 in both groups, and in the CS group we also considered a BMI not higher than 24.9 as inclusion criteria. None of them had history of cancer, rheumatologic, kidney or liver disease, or thyroid and parathyroid disorders or were using medication that interfere with glucose tolerance or serum lipid levels. This study was approved by the local ethics committee (registration code: C.I. 086) and all the participants signed a written informed consent in accordance with the Declaration of Helsinki.

Anthropometric measurements

Height was measured using a stadiometer (SECA Inc., México). Waist and hip circumferences were obtained in centimeters by a measuring tape (SECA 201). Body mass index (BMI; kg/m2), weight and body fat percentage (BFP) were obtained using a bioelectrical impedance scale (TFB-300A, Tanita®, Tokyo, Japan). All anthropometric measurements were performed in accordance to the International Society for the Advancement of Kinanthropometry standards.

Biochemical analysis

Blood samples were obtained by venipuncture with Vacutainer® system from all subjects after an 8 h overnight fasting period. Serum levels of fasting glucose (FG), triglycerides (TG), total cholesterol (TC) and high-density lipoprotein cholesterol (HDL-C) were determined using standard biochemical methods (BioSystems®, Barcelona, Spain). In addition, a subsample of the study individuals was made in order to measure total plasma ghrelin levels in duplicate with the RayBiotech, Inc., Norcross GA, USA enzyme immunoassay.

Genotyping

DNA isolation was performed by the Miller method [17]. Samples of DNA of each subject were analyzed by the polymerase chain reaction of restriction fragment-length polymorphisms (PCR-RFLPs) in order to determine the Leu72Met genotype. First, a PCR was carried out to amplify the region of the SNP using the following primers: forward 5′ TCTCTGGGCTTCAGTCTTCT 3′ and reverse 5′ CACTGCCACCTCTCCTGC 3′. PCR was performed in a final volume of 25 μL, containing 200 ng of gDNA, 20 μM of each primer, 1.5 U/μL of Taq polymerase (Fermentas Thermo Fisher Scientific®, Waltham MA, USA), 1X buffer, and 0.1 mM of each dNTP (Dongsheng Biotech Co., Guandong, China) with the next conditions: denaturation (95 °C 30 s), annealing (60 °C 30 s) and extension (72 °C 30 s) for 30 cycles performed on a programmable thermocycler (TC-300, Techne®, Staffs, UK). Finally, 10 μL of the amplified fragments by PCR were incubated for enzyme digestion with 1.5 U of BsrI restriction enzyme (New England Biolabs®, Ipswich MA, USA) for 20 min at 60 °C. PCR fragments and digestion products were analyzed in 2% agarose gel stained with Gel Red™ (Biotinum, Inc., Hayward CA, USA).

Statistical analysis

The significance of genotypic and allelic frequencies differences was compared using Chi square test. Student T-test and Mann-Whitney U test were used to compare quantitative variables according to their distribution. The association between genotypes or alleles with T2D was analyzed with Odds ratio (OR). Also, there was performed multiple and logistic regression models for the adjustment of ghrelin serum levels and genotype. It was considered as statistically significant when a two-tailed p-value ≤0.05 resulted. All statistical analyses were done by means of IBM SPSS 20.0 (SPSS, Inc., Chicago, IL, USA) and GraphPad Prism 8 (GraphPad Software®, La Jolla CA, USA).

Results

Basal characteristics of the study groups are shown in Table 1. T2D group showed a higher age and also significantly higher values in all clinical variables and anthropometrical variables than CS as expected. Ghrelin serum levels were evaluated in a subsample of 89 individuals (65 from T2D group and 24 CS) and we found significantly lower levels in serum T2D than in CS being: 50.5(60.8) pg/mL and 177.6(72.8) pg/mL respectively, Fig. 1 (values are expressed as median (interquartile range) p ≤ 0.0001). After an adjustment by age, body weight and BMI, the differences in serum ghrelin levels by groups remained significant (p ≤ 0.0001).

Table 1 Demographic, clinical and anthropometric characteristics of the study groups
Full size table
Fig. 1
figure 1

Serum ghrelin levels among study groups. CS control subjects (n = 24). T2D Type 2 Diabetes Mellitus group (n = 65). Values are expressed as median (interquartile range), adjusted using the multiple regression analys. Figure created with GraphPad Prism 8 software

Full size image

Genotypic and allelic distributions are shown in Table 2. Both allele and genotype proportions were in equilibrium according to Hardy-Weinberg’s law. Genotypic frequencies were significantly different between study groups (p ≤ 0.005). Both the Leu72Leu genotype and Leu72 allele, were markedly more frequent in T2D group than in CS. In the risk analysis, it was detected that the Leu72Met genotype and the 72Met allele were associated with decreased risk for T2D (OR 0.41 IC 95% 0.23–0.70; p = 0.0014 and OR 0.52 IC 95% 0.33–0.84; p = 0.006 respectively). After adjustment by age, body weight and BMI, Leu72Met genotype was no longer associated with T2D risk (p = 0.37), but the 72Met allele remained as a significant protective factor (OR 0.40 IC 95% 0.23–0.70; p ≤ 0.001). Serum ghrelin levels did not show differences when compared between genotypes (data not shown).

Table 2 Genotypic and allelic distribution in T2D and CS
Full size table

Discussion

This study aimed to describe the association between Leu72Met polymorphism and the risk of developing T2D in a Mexican population. We studied two groups, individuals with T2D and individuals with no T2D and with normal weight. As expected, T2D group showed significantly higher values in all clinical and metabolic variables, as compared to CS; this is explained by the natural history of T2D in which one or more of the following signs are common: overweight, obesity, high blood pressure, hyperglycemia and dyslipidemia [3]. On the other hand, lower serum ghrelin levels were detected in the T2D group. Since our groups were different in age distribution and the association between ghrelin levels body composition and age has been previously described [18, 19], we carried out an adjusted analysis in order to exclude the effect of age, body weight and BMI in our results. After adjusting, the difference detected in ghrelin levels in both groups remained significant (p ≤ 0.0001). About that, other studies have also encountered lower serum ghrelin levels in diabetic patients [20,21,22]. Given these results, it is possible that somehow T2D modifies ghrelin production. Tong J et.al., showed that the continuous infusion of ghrelin in healthy volunteers induced the suppression of glucose stimulated-insulin secretion [23]; in line with that, other studies have demonstrated that ghrelin increases plasma glucose levels and decreases fasting insulin levels [12]. A study by Sun Y et.al., were ghrelin gene was deleted in ob/ob mice showed a reduction in hyperglycemia and enhancement in glucose-induced insulin secretion [24]. It is possible that in T2D, lower ghrelin serum levels are produced by a compensatory mechanism that seeks to avoid the increment in circulating levels of glucose and those levels are independent of the effect of Leu72Met genotype.

Regarding the Leu72Met polymorphism, genotypic and allelic distributions of this study are in accordance to what has been reported before by Berthold HK, Bing C, Zavarella S in Caucasians and by Kim S in Asians [13, 25, 26]. When we compared genotypic and allelic frequencies between groups, both Leu72Leu genotype and 72Leu allele were a lot more frequent in T2D than in CS. The association analysis with T2D, showed that 72Met allele and Leu72Met genotype were protective against T2D, but after the adjustment, only the 72Met allele remained associated, suggesting that the protective effect of Leu72Met is given by 72Met allele. To this respect, it has been described that the 72Met allele induces protection against T2D in Caucasians [13], whereas the opposite occurs in Asiatic and Danish populations [14, 25, 27, 28]. Moreover, the 72Met allele has also, been associated as a protective against insulin resistance and body fat accumulation [26, 29]. Finally, the 72Met allele has been associated with BMI increase and early development of obesity in Japanese adults and in Italian adolescents [30, 31]. All of this evidence contributes to the controversial role of this polymorphism in T2D, where its effects in susceptibility varies in different ethnic groups as it has also been described for other human features. It is known that in humans, approximately 15% of the SNP’s are population-specific and the differences could be due to the different proportions of SNP alleles in a specific population [16, 32]. But at the moment, the underlying mechanisms of molecular evolution of this SNP between different populations is unclear. Our results are the first evidence about the relationship of this polymorphism and T2D susceptibility in Mexican population. However, this data should be interpreted with caution given the limited sample size of the study. There is a need of more studies for a better elucidation of the relation of genetic variations of the ghrelin gene with metabolic function in this population.

Conclusions

72Met allele of the Leu72Met polymorphism of GHRL gene decreases the risk of T2D development in Mexican population. Serum ghrelin levels are decreased in T2D patients as compared to CS independently with the Leu72Met polymorphism genotype in a Mexican population.

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request at the following e-mail: irism.llamas@gmail.com.

Abbreviations

T2D:

Type 2 Diabetes Mellitus

IDF:

International Diabetes Federation

GHRL :

Ghrelin Gene

GHSR1a:

Growth hormone secretagogue receptor

CS:

Control Subjects

BFP:

Body Fat Percentage

FG:

Fasting Glucose

TG:

Triglycerides

TC:

Total Cholesterol

DNA:

Deoxyribonucleic acid

PCR:

Polymerase Chain Reaction

RFLP:

Restriction Fragment Length Polymorphism

SNP:

Single Nucleotide Polymorphism

HDL-C:

High Density Lipoprotein

OR:

Odds Ratio

References

  1. Alam U, Asghar O, Azmi S, Malik RA. General aspects of diabetes mellitus. Handb Clin Neurol. 2014;126:211–22.

    Article  Google Scholar 

  2. User S. IDF diabetes atlas - Across the globe [Internet]. [citado 3 de octubre de 2019]. Disponible en: https://diabetesatlas.org/across-the-globe.html.

  3. Zheng Y, Ley SH, Hu FB. Global aetiology and epidemiology of type 2 diabetes mellitus and its complications. Nat Rev Endocrinol. 2018;14(2):88–98.

    Article  Google Scholar 

  4. IDF Diabetes Atlas: Global estimates of the prevalence of diabetes for 2011 and 2030 | Elsevier Enhanced Reader [Internet]. [citado 30 de septiembre de 2019]. Disponible en: https://reader.elsevier.com/reader/sd/pii/S0168822711005912?token=F06FB9971AE501AEA03D1D3B158080D9938B857E9F6724C5BE2FDF126BB11F50050EE75C1BB329B17D762992F6E71EB3.

  5. Whittemore R, Vilar-Compte M, De La Cerda S, Marron D, Conover R, Delvy R, et al. Challenges to diabetes self-management for adults with type 2 diabetes in low-resource settings in Mexico City: a qualitative descriptive study. Int J Equity Health. 2019;18 [citado 30 de octubre de 2019]. Disponible en: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6708131/.

  6. Meza R, Barrientos-Gutierrez T, Rojas-Martinez R, Reynoso-Noverón N, Palacio-Mejia LS, Lazcano-Ponce E, et al. Burden of type 2 diabetes in Mexico: past, current and future prevalence and incidence rates. Prev Med. 2015;81:445–50.

    Article  Google Scholar 

  7. la Cruz-Góngora VD, Martínez-Tapia B, Cuevas-Nasu L, Flores-Aldana M, Shamah-Levy T. Dietary intake and adequacy of energy and nutrients in Mexican older adults: results from two National Health and nutrition surveys. Salud Publica Mex. 2017;59(3):285–98.

    Article  Google Scholar 

  8. Gaona-Pineda EB, Mejía-Rodríguez F, Cuevas-Nasu L, Gómez-Acosta LM, Rangel-Baltazar E, Flores-Aldana ME. Dietary intake and adequacy of energy and nutrients in Mexican adolescents: results from Ensanut 2012. Salud Publica Mex. 2018;60(4):404–13.

    Article  Google Scholar 

  9. López-Olmedo N, Carriquiry AL, Rodríguez-Ramírez S, Ramírez-Silva I, Espinosa-Montero J, Hernández-Barrera L, et al. Usual intake of added sugars and saturated fats is high while dietary Fiber is low in the Mexican population. J Nutr. 2016;146(9):1856S–65S.

    Article  Google Scholar 

  10. Papatheodorou K, Papanas N, Banach M, Papazoglou D, Edmonds M. Complications of Diabetes 2016. J Diabetes Res. 2016;2016 [citado 30 de octubre de 2019]. Disponible en: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5086373/.

  11. Choi HJ, Cho YM, Moon MK, Choi HH, Shin HD, Jang HC, et al. Polymorphisms in the Ghrelin Gene Are Associated with Serum High-Density Lipoprotein Cholesterol Level and not with Type 2 Diabetes Mellitus in Koreans. None. 2006;91(11):4657–63.

    CAS  Google Scholar 

  12. Poher A-L, Tschöp MH, Müller TD. Ghrelin regulation of glucose metabolism. Peptides. 2018;100:236–42.

    Article  CAS  Google Scholar 

  13. Berthold HK, Giannakidou E, Krone W, Mantzoros CS, Gouni-Berthold I. The Leu72Met polymorphism of the ghrelin gene is associated with a decreased risk for type 2 diabetes. Clin Chim Acta. 2009;399(1–2):112–6.

    Article  CAS  Google Scholar 

  14. Liao N, Xie Z-K, Huang J, Xie Z-F. Association between the ghrelin Leu72Met polymorphism and type 2 diabetes risk: a meta-analysis. Gene. 2013;517(2):179–83.

    Article  CAS  Google Scholar 

  15. Gueorguiev M, Lecoeur C, Meyre D, Benzinou M, Mein CA, Hinney A, et al. Association studies on ghrelin and ghrelin receptor gene polymorphisms with obesity. Obesity. 2009;17(4):745–54.

    Article  CAS  Google Scholar 

  16. Huang R, Tian S, Cai R, Sun J, Shen Y, Wang S. Ethnicity-Specific Association Between Ghrelin Leu72Met Polymorphism and Type 2 Diabetes Mellitus Susceptibility: An Updated Meta-Analysis. Front Genet. 2018;9 [citado 23 de octubre de 2019]. Disponible en: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6246653/.

  17. Miller SA, Dykes DD, Polesky HF. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res. 1988;16(3):1215.

    Article  CAS  Google Scholar 

  18. Serra-Prat M, Fernández X, Burdoy E, Mussoll J, Casamitjana R, Puig-Domingo M, et al. The role of ghrelin in the energy homeostasis of elderly people: a population-based study. J Endocrinol Invest. 2007;30(6):484–90.

    Article  CAS  Google Scholar 

  19. Tschöp M, Weyer C, Tataranni PA, Devanarayan V, Ravussin E, Heiman ML. Circulating ghrelin levels are decreased in human obesity. Diabetes. 2001;50(4):707–9.

    Article  Google Scholar 

  20. Gómez-Díaz RA, Gómez-Medina MP, Ramírez-Soriano E, López-Robles L, Aguilar-Salinas CA, Saucedo R, et al. Lower Plasma Ghrelin Levels are Found in Women with Diabetes-Complicated Pregnancies. J Clin Res Pediatr Endocrinol. 2016;8(4):425–31.

    Article  Google Scholar 

  21. Ukkola O, Pöykkö SM, Antero KY. Low plasma ghrelin concentration is an indicator of the metabolic syndrome. Ann Med. 2006;38(4):274–9.

    Article  CAS  Google Scholar 

  22. Al Qarni AA, Joatar FE, Das N, Awad M, Eltayeb M, Al-Zubair AG, et al. Association of Plasma Ghrelin Levels with Insulin Resistance in Type 2 Diabetes Mellitus among Saudi Subjects. Endocrinol Metab (Seoul). 2017;32(2):230–40.

    Article  Google Scholar 

  23. Tong J, Prigeon RL, Davis HW, Bidlingmaier M, Kahn SE, Cummings DE, et al. Ghrelin suppresses glucose-stimulated insulin secretion and deteriorates glucose tolerance in healthy humans. Diabetes. 2010;59(9):2145–51.

    Article  CAS  Google Scholar 

  24. Sun Y, Asnicar M, Saha PK, Chan L, Smith RG. Ablation of ghrelin improves the diabetic but not obese phenotype of Ob/Ob mice. Cell Metab. 2006;3(5):379–86.

    Article  CAS  Google Scholar 

  25. Bing C, Ambye L, Fenger M, Jørgensen T, Borch-Johnsen K, Madsbad S, et al. Large-scale studies of the Leu72Met polymorphism of the ghrelin gene in relation to the metabolic syndrome and associated quantitative traits. Diabet Med. 2005;22(9):1157–60.

    Article  CAS  Google Scholar 

  26. Zavarella S, Petrone A, Zampetti S, Gueorguiev M, Spoletini M, Mein CA, et al. A new variation in the promoter region, the −604 C>T, and the Leu72Met polymorphism of the ghrelin gene are associated with protection to insulin resistance. Int J Obes (Lond). 2008;32(4):663–8.

    Article  CAS  Google Scholar 

  27. Li Y-Y, Lu X-Z, Yang X-X, Wang H, Geng H-Y, Gong G, et al. GHRL gene Leu72Met polymorphism and type 2 diabetes mellitus: a meta-analysis involving 8,194 participants. Front Endocrinol. 2019;10:559.

  28. Kim S-Y, Jo D-S, Hwang PH, Park JH, Park SK, Yi HK, et al. Preproghrelin Leu72Met polymorphism is not associated with type 2 diabetes mellitus. Metabolism. 2006;55(3):366–70.

    Article  CAS  Google Scholar 

  29. Ukkola O, Ravussin E, Jacobson P, Pérusse L, Rankinen T, Tschöp M, et al. Role of ghrelin polymorphisms in obesity based on three different studies. Obes Res. 2002;10(8):782–91.

    Article  CAS  Google Scholar 

  30. Kuzuya M, Ando F, Iguchi A, Shimokata H. Preproghrelin Leu72Met variant contributes to overweight in middle-aged men of a Japanese large cohort. Int J Obes (Lond). 2006;30(11):1609–14.

    Article  CAS  Google Scholar 

  31. Miraglia del Giudice E, Santoro N, Cirillo G, Raimondo P, Grandone A, D’Aniello A, et al. Molecular screening of the ghrelin gene in Italian obese children: the Leu72Met variant is associated with an earlier onset of obesity. Int J Obes Relat Metab Disord. 2004;28(3):447–50.

    Article  CAS  Google Scholar 

  32. Huang T, Shu Y, Cai Y-D. Genetic differences among ethnic groups. BMC Genomics. 2015;16:1093.

    Article  Google Scholar 

Download references

Acknowledgements

The authors would like to thank to the National Council of Science and Technology (CONACyT) and the PhD program of Molecular Biology in Medicine of the University of Guadalajara for the support.

Funding

There is no funding to declare.

Author information

Author notes

  1. Edgar Alfonso Rivera-León and Iris Monserrat Llamas-Covarrubias contributed equally to this work.

Authors and Affiliations

  1. Departamento de Biología Molecular y Genómica, Universidad de Guadalajara, Centro Universitario de Ciencias de la Salud, CUCS, Postal adress: Sierra Mojada 950, Colonia Independencia, CP, 44340, Guadalajara, Jalisco, Mexico

    Edgar Alfonso Rivera-León, Mara Anaís Llamas-Covarrubias, Erika Martínez-López, Mercedes González-Hita & Iris Monserrat Llamas-Covarrubias

  2. Departamento de Clínicas, Universidad de Guadalajara, Centro Universitario de los Altos, Tepatitlán de Morelos, Jalisco, Mexico

    Sergio Sánchez-Enríquez

Authors
  1. Edgar Alfonso Rivera-León
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Mara Anaís Llamas-Covarrubias
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Sergio Sánchez-Enríquez
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Erika Martínez-López
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Mercedes González-Hita
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. Iris Monserrat Llamas-Covarrubias
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

IMLC and EARL contributed equally in the design of the study, collection, processing of data, and manuscript preparation MALC, SSE and EML participated in the collection of data and statistical analysis, MGH participated in data interpretation and manuscript preparation. All authors read and approved the final manuscript.

Corresponding author

Correspondence to Iris Monserrat Llamas-Covarrubias.

Ethics declarations

Ethics approval and consent to participate

This study was approved by the University of Guadalajara ethics in research committee with the registration code: C.I.086 and all the participants signed a written informed consent in accordance with the Declaration of Helsinki.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Additional information

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Rivera-León, E.A., Llamas-Covarrubias, M.A., Sánchez-Enríquez, S. et al. Leu72Met polymorphism of GHRL gene decreases susceptibility to type 2 diabetes mellitus in a Mexican population. BMC Endocr Disord 20, 109 (2020). https://doi.org/10.1186/s12902-020-00596-3

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s12902-020-00596-3

Keywords

BMC Endocrine Disorders

ISSN: 1472-6823

Contact us