Skip to main content


We’d like to understand how you use our websites in order to improve them. Register your interest.

A Chinese patient with 11β-hydroxylase deficiency due to novel compound heterozygous mutation in CYP11B1 gene: a case report



Congenital adrenal hyperplasia (CAH) resulting from steroid 11β-hydroxylase deficiency (11β-OHD) is caused by mutations in the CYP11B1 gene. It is the second major form of CAH associated with hypertension and hypopotassemia. The aim of this study was to provide a genetic analysis of 11β-OHD in a Chinese family.

Case presentation

A 19-year-old Chinese man was clinically diagnosed with 11β-OHD. His initial clinical manifestations included precocious puberty, hyperpigmentation, hypertension, and hypopotassemia. The patient had taken an overdose of dexamethasone (0.75 mg/d) for more than 10 years before finally developing iatrogenic Cushing’s syndrome. Our aim was to perform a molecular diagnosis of his family. Mutations in the CYP11B1 gene of the patient and his parents were examined using polymerase chain reaction (PCR) resequencing. Additionally, to predict the possible effects of novel mutations on the structure and function of 11β-hydroxylase, these mutations were analyzed by MutationTaster software. Two novel pathogenic mutations were found in the CYP11B1 gene: a heterozygous in-frame insertion deletion mutation c.1440_1447delinsTAAAAG in exon 9 inherited from the father and a heterozygous mutation c.1094_1120delTGCGTGCGGCCCTCAAGGAGACCTTGC (p.364_372del) in exon 6 inherited from the mother.


A clear genetic diagnosis can be made by analyzing the functional and structural consequences of CYP11B1 gene mutations that lead to 11β-OHD. Because the dosage of glucocorticoid should be adjusted to minimize the risk of iatrogenic Cushing’s syndrome, clinical follow-up should be conducted with these patients.

Peer Review reports


Congenital adrenal hyperplasia (CAH) is an autosomal recessive disorder caused by the loss or severe decrease in activity in one of the steroidogenic enzymes involved in cortisol biosynthesis. The majority of cases are caused by 21-hydroxylase deficiency (21-OHD) [1,2,3], followed by 11β-hydroxylase deficiency (11β-OHD) in Jews of Moroccan origin, people of Turkish descent, and Han Chinese. In the general Caucasian population, it has a prevalence of 5–8% and occurs in approximately 1:100,000 to 1:200,000 of live births [4,5,6,7].

The 11β-hydroxylase converts 11-deoxycortisol and 11-deoxycorticosterone (DOC) to cortisol and corticosterone, respectively, and it is regulated by the adrenocorticotropic hormone (ACTH) secreted by the pituitary gland. A deficit of 11β-hydroxylase, however, causes decreased production of cortisol, accumulation of steroid precursors and an overproduction of androgens. Therefore, the classical form of 11β-OHD is characterized by genital ambiguity in female patients [4] and precocious puberty, rapid somatic growth and bone age acceleration in both genders as a result of hyperandrogenemia. Hypertension occurs in approximately two-thirds of these patients because of the accumulation of steroid precursors, primarily deoxycorticosterone. In contrast, this symptom is not seen in patients with 21-OHD.

The 11β-OHD is caused by the mutation of the 11β-hydroxylase gene (CYP11B1), which is located on chromosome 8q21. This gene contains 9 exons, approximately 40 kilobases apart from the highly homologous aldosterone synthase gene (CYP11B2) [8, 9]. Herein, we first report the observation of classic features with two novel mutations genetically confirmed for 11β-OHD in a Chinese family.

Case presentation

The patient was born after a full-term delivery by natural labor, and his parents had a non-consanguineous marriage. A large phallus and skin hyperpigmentation were observed at birth. He presented with deep voice and accelerated growth rate at the age of 12 months. At 6.5 years, the appearance of pubic hair was reported. He was admitted to a pediatric hospital at the age of 7.3 years. His height was 144.5 cm (+ 3.6 SDS, according to the 2009 height standardized growth chart for Chinese children and adolescents aged 2 to 18 years old). He presented with more dark skin, a larger phallus, advanced bone age, and high blood pressure (160/100 mmHg). A laboratory investigation showed the following results: potassium 3.06 mmol/L; sodium 142.1 mmol/L; testosterone more than 750 ng/dL; follicle stimulating hormone (FSH) 27.2 mIU/ml; luteinizing hormone (LH) 4.2 mIU/ml; morning serum cortisol 1.1 μg/dl; and adrenocorticotropic hormone (ACTH) 673 pg/ml (Table 1). A computed tomography scan showed bilateral adrenal enlargement, as shown in Fig. 1a. He was diagnosed with congenital adrenal hyperplasia resulting from 11β-OHD and began the dexamethasone treatment. After taking dexamethasone, the patient achieved normal sodium and potassium and decreased blood pressure (130/80 mmHg).

Table 1 Biochemical and hormonal findings of the patient before and after treatment with glucocorticoid
Fig. 1

Adrenal computed tomographic scan. a 13 years ago (age: 7 years, 3 months), before treatment, the scan revealed bilateral adrenal hyperplasia (red arrow). b On admission (age: 19 years), after treatment with dexamethasone, the scan showed bilateral adrenal atrophy (yellow arrow)

The patient took dexamethasone 0.75 mg/d for more than 10 years without follow-up or dose titration, and gradually developed symptoms of weight gain, round face, ecchymoses, striae, acne, hyperuricemia, and recurrent tinea corporis. Additionally, his blood pressure rose to 150/100 mmHg. He reached his final adult height at 8 years old (148 cm, + 3.2 SDS). The patient was referred to our hospital with the complaint of short stature when he was 19 years old (148 cm, − 4.0 SDS). At this visit, he presented with blood pressure of 160/120 mmHg, a body mass index (BMI) of 36.5 kg/m2, and a waist circumference of 110 cm, with the appearance of typical Cushing’s syndrome with neck acanthosis nigricans (Fig. 2). The laboratory test results showed the following (Table 1): ACTH less than 5 pg/ml; cortisol 1.24 μg/dl; testosterone 2.33 ng/ml; progesterone 0.16 ng/ml; 17α-hydroxyprogesterone 1.66 ng/ml; dehydro-epiandrosterone sulfate (DHEA-S) 26.9 μg/ml; potassium 5.0 mmol/L and sodium 137 mmol/L. A computed tomography scan revealed bilateral adrenal atrophy (Fig. 1B). He was diagnosed with hyperinsulinemia, hyperuricemia, hyperlipidemia, and fatty liver. The patient was diagnosed with iatrogenic Cushing’s syndrome. Due to significantly inhibition ACTH, elevated plasma renin activity, and bilateral adrenal atrophy, we speculated that the patient was deficient in mineralocorticoids. He stopped taking dexamethasone and began prednisone (7.5 mg/d). The patient was prescribed nifedipine controlled-release tablets (60 mg/d) and metoprolol succinate sustained-release tablets (47.5 mg/d), and his blood pressure was controlled at 138–148/90–106 mmHg. Four months after switching from dexamethasone to prednisone, the patient came to our clinic for follow-up and had decreased body weight (6 kg), normal blood pressure (120/70 mmHg), and normal serum potassium levels.

Fig. 2

General appearance of the patient. (A) At the neck, clavicle fat pad and acanthosis nigricans was found. (B) On his lower trunk, central obesity and striae were noted. (1) Before changing medication from dexamethasone to prednisone. (2) Four months after changing medication from dexamethasone to prednisone

Written informed consent was obtained from the patient and his parents before the genetic investigation. CYP11B1 (NM_000497) gene was analyzed by direct sequencing using genomic DNA extracted from leucocytes of peripheral blood by EZNA Blood DNA Midi Kit (Atlanta, GA, US). Briefly, PCR was performed in a 20 μL reaction volume containing 50 ng of genomic DNA, 10 μL of 2 × GC PCR buffer, 0.1 μM of each dNTP, 0.1 μM of each primer, and 1.25 units of rTaq polymerase (Takara, Shiga, Japan) in a thermocycler (ABI9700, US). For all of the amplicons, the genomic DNA was denatured at 94 °C for 10 min, followed by 35 cycles of denaturation at 94 °C for 30 s, 60 °C for 30 s, and 72 °C for 1 min 40 s. The final extension was at 72 °C for 10 min. To prevent amplification of highly homologous CYP11B2 sequences, the CYP11B1 gene was amplified in four fragments using four unique primer pairs (Additional file 1: Table S1: Primers used for PCR assay of CYP11B1 gene) [10, 11]. Amplified products were detected by agarose gel electrophoresis and sequenced using an ABI3730 DNA Analyzer (Applied Biosystems). Each individual was identified according to the sequencing results using SeqMan software. To predict the functional effects of novel mutations, the sequence alterations were assessed using in silico prediction algorithms in MutationTaster (an online program at, which automatically provides the probability for a variation to be either a pathogenic mutation or a benign polymorphism.

Analysis of the CYP11B1 gene disclosed two novel mutations (Fig. 3): a heterozygous in-frame insertion deletion mutation c.1440_1447delinsTAAAAG in exon 9 inherited from the father and a heterozygous mutation c.1094_1120delTGCGTGCGGCCCTCAAGGAGACCTTGC (p.364_372del) in exon 6 inherited from the mother. These two novel frameshift mutations resulted in both amino acid sequences and splice site changes. Like the deletion mutation inherited from the mother, the mutation c.1440_1447delinsTAAAAG also prolonged the protein sequence. These two novel mutations were not observed in the Exome Aggregation Consortium (ExAC) or 1000 Genomes databases, indicating that the variants were rare. To further determine whether these two mutations were indeed potential pathogenic factors, the CYP11B1 sequence variations of c.1440_1447delinsTAAAAG and c.1094_1120delTGCGTGCGGCCCTCAAGGAGACCTTGC (p.364_372del) were both automatically predicted by MutationTaster to be disease-causing mutation (Table 2). In addition, we also identified two polymorphic loci in the patient’s CYP11B1 gene at exon 1 (c.225A > G, p.Leu75Leu) and exon 2 (c.246C > T, p.Asp82Asp).

Fig. 3

Mutation analysis by direct DNA sequencing. a Pedigree illustrating the segregation of the mutant alleles to the index patient (II.1). b The left panel shows the deletion at c.1094_1120delTGCGTGCGGCCCTCAAGGAGACCTTGC, which results in the deletion of nine amino acids at position 364_372 (p.364_372del). The mother (I.2) and the patient (II.1) are heterozygous for c.1094_1120delTGCGTGCGGCCCTCAAGGAGACCTTGC mutation, whereas the father shows the wild-type sequence at this position. The indel mutation c.1440_1447delinsTAAAAG, leading to original stopcodon lost, results in elongated protein. The patient was found to be heterozygous for this mutation was found in the heterozygous state in the patient (II.1) and the father (I.1). The mother carries the homozygous wild-type allele at this position

Table 2 Bioinformatics analysis of two novel mutations

Discussion and conclusion

Clinical presentation, laboratory findings, and genetic features indicated the diagnosis of CAH resulting from 11β-OHD in our patient, which appeared to be a compound heterozygote for two novel mutations in the CYP11B1 gene.

11β-hydroxylase, one of the cytochrome P-450 enzymes, consists of 503 amino acids [12]. To date, a cluster of mutations have been reported, some of which affect the spatial conformation of 11β-hydroxylase to varying degrees, in particular to maintain the conformation of the key region of the enzyme activity [13,14,15,16,17]. Some mutations could change the reading frame, resulting in production of the wrong protein. If the premature termination appears in advance, the protein expression is terminated prematurely, causing the corresponding functional domain of the protein to change or disappear and the enzyme activity to be lost, accordingly [18,19,20,21].

In this study, we identified a novel mutation, c.1094_1120delTGCGTGCGGCCCTCAAGGAGACCTTGC in exon 6, which resulted in the deletion of 9 amino acids at position 364_372 (p.364_372del). CYP11B1, a cytochrome P-450 enzyme, uses heme as a prosthetic group to catalyze redox reactions [22]. The three-dimensional structure of the protein shows that I-, K-, and L-helixes contain a highly conserved heme-binding area [22]. The amino acid residues 364_372 constitute the putative K-helix of the CYP11B1 model [22]. The deletion of amino acid residues 364_372 may have resulted in defection of the K-helix. The side chain of R366 faces toward the protein surface, maintaining a positive surface charge. Additionally, the positive surface charge is involved in the CYP-Adx interaction, which is fundamental for CYP11B1 function [14]. A368 was located in a hydrophobic environment and interacted with the hydrophobic side chains of the amino acid residues V336 and L340 located in the J-helix [17]. The change in A368 resulted in a disorientation of the J-helix, I-helix, or K-L loop, containing a meander region and C450 coordinating the heme iron [17]. Changing this structure’s orientation resulted in substantial changes of both the protein conformation and the heme group orientation relative to the enzyme [17]. E371 at the end of the K-helix might be located in the conserved central core of the P450 enzymes, and the protein domain around the conserved central core could be of fundamental importance [15]. We speculate that p.364–372 del could decrease or abolish CYP11B1 activity by preventing the formation of the K-helix, which in turn would affect the tertiary structure of the protein.

In addition, we also identified c.1440–1447 delins TAAAAG in exon 9, leading to the loss of original stop codon and resulting in an elongated protein. L487-A501 is conserved in humans, rats, and mice [22]. One study reported that the last 10 amino acids in the C-terminal region of the CYP11B1 gene have little effect on CYP11B1 function [23]. It is not clear whether the C-terminal protein elongation will affect the three-dimensional structure of the enzyme and thus reduce its activity. We speculate that the mutation of c.1440_1447delinsTAAAAG in exon 6 could be the primary cause of the 11β-OHD in our patient. Combining in vitro expression studies with protein structure analysis is a powerful means of providing new insights in the understanding of structural–functional relationships.

The patient in this article took an unnecessarily high dose of dexamethasone over a long period without regular follow-up or dose adjustment, and he ultimately developed iatrogenic Cushing’s syndrome and reduced final height. The treatment of 11β-OHD is generally identical to that of 21-OHD. Glucocorticoid doses should be adjusted to reduce the risk of iatrogenic Cushing’s syndrome and growth impairment, but stress doses of glucocorticoids are necessary in cases of acute illness [24, 25]. Monitoring with plasma DOC and plasma renin activity can be helpful. Additional antihypertensive treatment may be required if blood pressure remains elevated, despite optimal glucocorticoid treatment. Supplemental treatments to maintain the balance of electrolytes and blood pressure include spironolactone, amiloride, and calcium channel blockers [7, 24]. Since the renin-angiotensin system is suppressed in these patients, angiotensin-converting enzyme inhibitors and angiotensin receptor II blockers should be avoided.

The management of CAH can be complicated by iatrogenic Cushing’s syndrome, inadequately treated hyperandrogenism, or both. Patients treated with supraphysiological doses of glucocorticoids not only experienced slowed growth but could also exhibit the signs and symptoms of iatrogenic Cushing’s syndrome. Thus, we emphasized the importance of clinical follow-up. Close clinical monitoring of symptoms and signs, growth and development, and laboratory results are essential to optimize treatment outcomes.

In conclusion, our findings demonstrated the presence of the 11β-OHD phenotype with two novel pathogenic mutations of the CYP11B1 gene in a Chinese patient. On the basis of our results, the outcome of this study has paved the way for a more efficient diagnosis and genetics counseling for diagnosis of patients with this disorder in China. Further research is required, however, to determine in vitro expression studies and protein structure analysis that may affect 11β-hydroxylase activity.



11β-hydroxylase deficiency




21-hydroxylase deficiency


Adrenocorticotropic hormone






Body mass index


Congenital adrenal hyperplasia

CYP11B1 :

11β-hydroxylase gene

CYP11B2 :

Aldosterone synthase gene


Dehydro-epiandrosterone sulfate



E2 :



Follicle stimulating hormone


High-density lipoprotein cholesterol


Low-density lipoprotein cholesterol


Luteinizing hormone




Plasma renin activity




Total cholesterol




Uric acid


  1. 1.

    Witchel SF, Aston CE. The role of heterozygosity for CYP21 in the polycystic ovary syndrome. J Pediatr Endocrinol Metab. 2000;13(Suppl 5):1315–7.

  2. 2.

    Speiser PW, White PC. Congenital adrenal hyperplasia. N Engl J Med. 2003;349(8):776–88.

  3. 3.

    Merke DP, Bornstein SR. Congenital adrenal hyperplasia. Lancet. 2005;365(9477):2125–36.

  4. 4.

    Zachmann M, Tassinari D, Prader A. Clinical and biochemical variability of congenital adrenal hyperplasia due to 11 beta-hydroxylase deficiency. A study of 25 patients. J Clin Endocrinol Metab. 1983;56(2):222–9.

  5. 5.

    Han B, Xue L, Fan M, Zhao S, Liu W, Zhu H, et al. Clinical and molecular manifestation of fifteen 17OHD patients: a novel mutation and a founder effect. Endocrine. 2016;53(3):784–90.

  6. 6.

    White PC, Curnow KM, Pascoe L. Disorders of steroid 11 beta-hydroxylase isozymes. Endocr Rev. 1994;15(4):421–38.

  7. 7.

    Peter M. Congenital adrenal hyperplasia. 11beta-hydroxylase deficiency. Semin Reprod Med. 2002;20(3):249–54.

  8. 8.

    White PC. Steroid 11 beta-hydroxylase deficiency and related disorders. Endocrinol Metab Clin N Am. 2001;30(1):61–79.

  9. 9.

    Chua SC, Szabo P, Vitek A, Grzeschik KH, John M, White PC. Cloning of cDNA encoding steroid 11 beta-hydroxylase (P450c11). Proc Natl Acad Sci U S A. 1987;84(20):7193–7.

  10. 10.

    Xu L, Xia W, Wu X, Wang X, Zhao L, Nie M. Chimeric CYP11B2/CYP11B1 causing 11beta-hydroxylase deficiency in Chinese patients with congenital adrenal hyperplasia. Steroids. 2015;101:51–5. Epub 2015 Jun 9.

  11. 11.

    Chabre O, Portrat-Doyen S, Chaffanjon P, Vivier J, Liakos P, Labat-Moleur F, Chambaz E, Morel Y, Defaye G. Bilateral laparoscopic adrenalectomy for congenital adrenal hyperplasia with severe hypertension, resulting from two novel mutations in splice donor sites of CYP11B1. J Clin Endocrinol Metab. 2000 Nov;85(11):4060–8.

  12. 12.

    Kawainoto T, Mitsuuchi Y, Ohnishi T, Ichikawa Y, Yokoyama Y, Sumimoto H, et al. Cloning and expression of a cDNA for human cytochrome P-450aldo as related to primary aldosteronism. Biochem Biophys Res Commun. 1990;173(1):309–16.

  13. 13.

    Khattab A, Haider S, Kumar A, Dhawan S, Alam D, Romero R, et al. Clinical, genetic, and structural basis of congenital adrenal hyperplasia due to 11beta-hydroxylase deficiency. Proc Natl Acad Sci U S A. 2017;114(10):E1933–40.

  14. 14.

    Parajes S, Loidi L, Reisch N, Dhir V, Rose IT, Hampel R, et al. Functional consequences of seven novel mutations in the CYP11B1 gene: four mutations associated with nonclassic and three mutations causing classic 11{beta}-hydroxylase deficiency. J Clin Endocrinol Metab. 2010;95(2):779–88.

  15. 15.

    Geley S, Kapelari K, Johrer K, Peter M, Glatzl J, Vierhapper H, et al. CYP11B1 mutations causing congenital adrenal hyperplasia due to 11 beta-hydroxylase deficiency. J Clin Endocrinol Metab. 1996;81(8):2896–901.

  16. 16.

    Curnow KM, Slutsker L, Vitek J, Cole T, Speiser PW, New MI, et al. Mutations in the CYP11B1 gene causing congenital adrenal hyperplasia and hypertension cluster in exons 6, 7, and 8. Proc Natl Acad Sci U S A. 1993;90(10):4552–6.

  17. 17.

    Krone N, Grischuk Y, Muller M, Volk RE, Grotzinger J, Holterhus PM, et al. Analyzing the functional and structural consequences of two point mutations (P94L and A368D) in the CYP11B1 gene causing congenital adrenal hyperplasia resulting from 11-hydroxylase deficiency. J Clin Endocrinol Metab. 2006;91(7):2682–8.

  18. 18.

    Ben CI, Riepe FG, Kahloul N, Kulle AE, Adala L, Mamai O, et al. Two novel CYP11B1 mutations in congenital adrenal hyperplasia due to steroid 11beta hydroxylase deficiency in a Tunisian family. Gen Comp Endocrinol. 2012;175(3):514–8.

  19. 19.

    Xu C, Qiao J, Liu W, Jiang X, Yan F, Wu J, et al. Identification and functional characterization of a large deletion of the CYP11B1 gene causing an 11beta-hydroxylase deficiency in a Chinese pedigree. Horm Res Paediatr. 2012;78(4):212–7.

  20. 20.

    Zhang M, Liu Y, Sun S, Zhang H, Wang W, Ning G, Li X. A prevalent and three novel mutations in CYP11B1 gene identified in Chinese patients with 11-beta hydroxylase deficiency. J Steroid Biochem Mol Biol. 2013;133:25–9.

  21. 21.

    Soardi FC, Penachioni JY, Justo GZ, Bachega TA, Inacio M, Mendonca BB, et al. Novel mutations in CYP11B1 gene leading to 11 beta-hydroxylase deficiency in Brazilian patients. J Clin Endocrinol Metab. 2009;94(9):3481–5.

  22. 22.

    Belkina NV, Lisurek M, Ivanov AS, Bernhardt R. Modelling of three-dimensional structures of cytochromes P450 11B1 and 11B2. J Inorg Biochem. 2001;87(4):197–207.

  23. 23.

    Portrat S, Mulatero P, Curnow KM, Chaussain JL, Morel Y, Pascoe L. Deletion hybrid genes, due to unequal crossing over between CYP11B1 (11beta-hydroxylase) and CYP11B2(aldosterone synthase) cause steroid 11beta-hydroxylase deficiency and congenital adrenal hyperplasia. J Clin Endocrinol Metab. 2001;86(7):3197–201.

  24. 24.

    Bulsari K, Falhammar H. Clinical perspectives in congenital adrenal hyperplasia due to 11beta-hydroxylase deficiency. Endocrine. 2017;55(1):19–36.

  25. 25.

    Nimkarn S, New MI. Steroid 11beta- hydroxylase deficiency congenital adrenal hyperplasia. Trends Endocrinol Metab. 2008;19(3):96–9.

Download references


This study was supported by grants from the National Key Program of Clinical Science (WBYZ2011–873) and the National Key Research and Development Program of China (2016YFC0901500), which were mainly for the collection, genetic analysis, and interpretation of data.

Availability of data and materials

All data generated and analyzed during this study are included in this published article and are available from the corresponding author upon reasonable request. The two novel mutations are not observed in the ExAC and 1000 Genomes database.

Author information




LL, SC, HJZ, HP, ZLL, and XQW diagnosed the patient, provided follow-up, and acquired clinical data. JJ and ZHL completed the genetic analysis. LL and XXY conducted investigations, reviewed literature, drafted the manuscript, and reviewed the manuscript for final publication. All of the authors read and approved the final manuscript.

Corresponding author

Correspondence to Lin Lu.

Ethics declarations

Ethics approval and consent to participate

The study was performed in accordance with the Declaration of Helsinki and was approved by Peking Union Medical College Hospital’s Research and Ethical Committee (JS1233).

Consent for publication

Written informed consent was obtained from the patient and his parents, including the permission for details and images related to the patient and his parents to be published. The patient and his parents were informed that the details and images would be freely available on the internet and may be seen by the general public. Copies of the consent forms are available for review by the editor of this journal.

Competing interests

The authors declare that they have no competing interests.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Additional files

Additional file 1:

Table S1. Primers Used for PCR Assay of CYP11B1 Gene. (DOCX 17 kb)

Rights and permissions

Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (, which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver ( applies to the data made available in this article, unless otherwise stated.

Reprints and Permissions

About this article

Verify currency and authenticity via CrossMark

Cite this article

Yuan, X., Lu, L., Chen, S. et al. A Chinese patient with 11β-hydroxylase deficiency due to novel compound heterozygous mutation in CYP11B1 gene: a case report. BMC Endocr Disord 18, 68 (2018).

Download citation


  • 11β-hydroxylase deficiency
  • CYP11B1 gene mutation
  • Iatrogenic Cushing’s syndrome