Skip to main content

Table 2 Bioinformatics analysis of two novel mutations

From: A Chinese patient with 11β-hydroxylase deficiency due to novel compound heterozygous mutation in CYP11B1 gene: a case report

Novel mutation Bioinformatics analysis
MutationTaster Domain Type
prediction Score
c.1094_1120delTGCGTGCGGCCCTCAAGGAGACCTTGC, p.364_372del disease causing 0.999 K-helix
c.1440_1447delinsTAAAAG, original stop codon lost, results in prolonged protein disease causing 0.999 C-term
  1. MutationTaster Prediction: polymorphism or disease causing