A Chinese patient with 11β-hydroxylase deficiency due to novel compound heterozygous mutation in CYP11B1 gene: a case report

Table 2 Bioinformatics analysis of two novel mutations

Novel mutation	Bioinformatics analysis
	MutationTaster		Domain Type
	prediction	Score	Domain Type
c.1094_1120delTGCGTGCGGCCCTCAAGGAGACCTTGC, p.364_372del	disease causing	0.999	K-helix
c.1440_1447delinsTAAAAG, original stop codon lost, results in prolonged protein	disease causing	0.999	C-term

ISSN: 1472-6823