Primary bilateral macronodular adrenocortical hyperplasia (PBMAH) patient with ARMC5 mutations

BMC Endocrine Disorders

Table 3 The somatic ARMC5 variants in the bilateral adrenal mass

Location	Gene symbol	Transcripts	Genomic location	cHGVS	pHGVS	ExIn ID	Mutation frequency	MutationTaster	SIFT	PolyPhen-2	ExAC or 1000G
Right adrenal	ARMC5	NM_001105247.1	16p11.2	c.284C > A	p.S95^*	EX1	20.1%	Disease causing	Deleterious	Benign	−/−
Right adrenal	ARMC5	NM_001105247.1	16p11.2	c.294Gdel	p.G99Efs^*38	EX1	10.4%	Disease causing	Deleterious	Benign	−/−
Right adrenal	ARMC5	NM_001105247.1	16p11.2	c.1572_1607delAGCCCTGCTGCTGCTGTCGCGCTTTTCCCAGGCCCC	p.A525_P536del	EX4	2.0%	Disease causing	Deleterious	Benign	−/−
Left adrenal	ARMC5	NM_001105247.1	16p11.2	c.435C > A ^a	p.C145^*	EX1	4.5%	Disease causing	Deleterious	Benign	−/−
Left adrenal	ARMC5	NM_001105247.1	16p11.2	c.2542G > T	p.E848^*	EX6	2.1%	Disease causing	Deleterious	Benign	−/−

HGVS Human Genome Variation Society, ExIn exon-intron, ExAC the Exome Aggregation Consortium, 1000G 1000 Genomes
^a this mutation has been reported in the Catalogue Of Somatic Mutations In Cancer (COSMIC)

ISSN: 1472-6823