Skip to main content

Table 3 Primer design for the PPARγ assay

From: The role of CD36-Fabp4-PPARγ in skeletal muscle involves insulin resistance in intrauterine growth retardation mice with catch-up growth

PPARγ primo* assay, designed by PyroMark, Qiagoi
Amplicon product
Forward primer TGTGTGATTAGGAGTTTTAATTAAAG
Reverse primer ACCTTAATCTCTAAATTATAAAACACC
Sequencing primer TCTAAATTATAAAACACCAAATAAA
Sequence intended for analysis GTTTGGGATAGGTTGGGATATTCGGGATTTGATATTTGGCGGAGTTTAACGTGGGAATTAAAAATAGTTATTTCGGGTTATTTCGGGGTATATATATATATATATATATATATATATATATATACGCGGGTTTTATGTTATTTTGTTGGAGTTATT (93 bp)