Skip to main content

Table 2 Primer sequences used for PCR

From: Circ_0000064 promotes high glucose-induced renal tubular epithelial cells injury to facilitate diabetic nephropathy progression through miR-532-3p/ROCK1 axis

Name   Primers for PCR (5′-3′)
circ_0000064 Forward CTAGAGGCGGTGGCGTTG
Reverse TGAGGTCCCCAGTGCCC
ROCK1 Forward AAATTGCTTTCCGCTGCTGG
Reverse CGCAGCAGGTTGTCCATTTT
miR-532-3p Forward GCCGAGCCTCCCACACCCAAGG
Reverse CTCAACTGGTGTCGTGGAG
β-actin Forward CTTCGCGGGCGACGAT
Reverse CCACATAGGAATCCTTCTGACC
U6 Forward CTCGCTTCGGCAGCACA
Reverse AACGCTTCACGAATTTGCGT