Skip to main content

Table 2 Primer design for the PGC-1α assay

From: The role of CD36-Fabp4-PPARγ in skeletal muscle involves insulin resistance in intrauterine growth retardation mice with catch-up growth

PGC-1α primo* assay, designed by PyroMark, Qiagoi
Amplicon product
Forward primer TGTAGGAGATTTGAGTTATTATGTGAG
Reverse primer ACCTTTAAAAAACTTCAAACATCAC
Sequencing primer GAGTTATTATGTGAGTAGGGTTT
Sequence intended for analysis TGTAGGAGATTTGAGTTATTATGTGAGTAGGGTTTCGGTTTAGAGTTGGTGGTATTTAAAGTTGGTTTTAGTTATAGTGTGATGTTTGAAGTTTTTTAAAGGT (103 bp)