Skip to main content

Table 1 Primer sequences

From: The role of CD36-Fabp4-PPARγ in skeletal muscle involves insulin resistance in intrauterine growth retardation mice with catch-up growth

Primer Sequence (5′ → 3′)
PPARγ F: CTGACCCAATGGTTGCTGATTAC
R: GGACGCAGGCTCTACTTTGATC
Fabp4 F: CCCTGCCATTGTTAAGACC
R: TGCTGCTGTTCCTGTTTTC
CD36 F: GGCTAAATGAGACTGGGACC
R: CAAACATCACCACTCCAATCC
FAS F: ATCTGGGCTGTCCTGCCTCT
R: CAGTTTCACGAACCCGCCT
ACC1 F: GCTAAAGGGCGATCTCAACAAAG
R: TTCTCTCCGTGGTTAGGGTTCT
PGC-1a F: CAAGACCAGGAAATCCGAG
R: TGAAGTCGCCATCCCTTAG